 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0032462 | |||
| Gene | SIPA1L1 | Organism | Human |
| Genome Locus | chr14:72054287-72090953:+ | Build | hg19 |
| Disease | Osteosarcoma | ICD-10 | Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41) |
| DBLink | Link to database | PMID | 30153287 |
| Experimental Method | |||
| Sample Type | Cell Lines | Comparison | The human osteosarcoma cell lines MG63, U2OS, 143B, HOS and the human osteoblast cell line hFOB1.19 were obtained from the American Type Culture Collection (ATCC) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGAAACTGGATGAACAAGGGAG ReverseGCCGTCTGTGCCAACAAC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Chen, G, Wang, Q, Yang, Q, Li, Z, Du, Z, Ren, M, Zhao, H, Song, Y, Zhang, G (2018). Circular RNAs hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 are predicted to promote CADM1 expression by functioning as miRNAs sponge in human osteosarcoma. PLoS ONE, 13, 8:e0202896. | |||